|
|
EMBOSS: extractseq |
This is modelled on the cell's process of splicing out exons from mRNA, but the program is generally applicable to any cutting and splicing or editing operation on a single sequence.
extractseq reads in a sequence and a set of regions of that sequence as specified by pairs of start and end positions (either on the command-line or contained in a file) and writes out the specified regions of the input sequence in the order in which they have been specified. Thus, if the sequence "AAAGGGTTT" has been input and the regions: "7-9, 3-4" have been specified, then the output sequence will be: "TTTAG".
% extractseq main.seq result.seq -regions '10-20'
Extract the regions 10 to 20, 30 to 45, 533 to 537
% extractseq main.seq result2.seq -regions '10-20, 30-45, 533-537'
Mandatory qualifiers:
[-sequence] seqall Sequence database USA
[-outseq] seqoutall Output sequence(s) USA
-regions range Regions to extract.
A set of regions is specified by a set of
pairs of positions.
The positions are integers.
They are separated by any non-digit,
non-alpha character.
Examples of region specifications are:
24-45, 56-78
1:45, 67=99;765..888
1,5,8,10,23,45,57,99
Optional qualifiers:
-separate bool If this is set true then each specified
region is written out as a separate
sequence. The name of the sequence is
created from the name of the original
sequence with the start and end positions of
the range appended with underscore
characters between them, eg: XYZ region 2 to
34 is written as: XYZ_2_34
Advanced qualifiers: (none)
General qualifiers:
-help bool report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
|
| Mandatory qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-sequence] (Parameter 1) |
Sequence database USA | Readable sequence(s) | Required |
| [-outseq] (Parameter 2) |
Output sequence(s) USA | Writeable sequence(s) | <sequence>.format |
| -regions | Regions to extract. A set of regions is specified by a set of pairs of positions. The positions are integers. They are separated by any non-digit, non-alpha character. Examples of region specifications are: 24-45, 56-78 1:45, 67=99;765..888 1,5,8,10,23,45,57,99 | Sequence range | Whole sequence |
| Optional qualifiers | Allowed values | Default | |
| -separate | If this is set true then each specified region is written out as a separate sequence. The name of the sequence is created from the name of the original sequence with the start and end positions of the range appended with underscore characters between them, eg: XYZ region 2 to 34 is written as: XYZ_2_34 | Yes/No | No |
| Advanced qualifiers | Allowed values | Default | |
| (none) | |||
You can specifiy a file of ranges to extract by giving the '-regions' qualifier the value '@' followed by the name of the file containing the ranges. (eg: '-regions @myfile').
The format of the range file is:
An example range file is:
# this is my set of ranges 12 23 4 5 this is like 12-23, but smaller 67 10348 interesting region
For example, the coding regions of em:hsfau1 are joined as:
% extractseq em:hsfau1 -reg "782..856,951..1095,1557..1612,1787..1912" stdout >HSFAU X65923 H.sapiens fau mRNA atgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacg gtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtc gtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggag gccctgactaccctggaagtagcaggccgcatgcttggaggtaaagttcatggttccctg gcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaag aagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtg cccacctttggcaagaagaagggccccaatgccaactcttaa
If the option '-separate' is used then each specified region is written to the output file as a separate sequence. The name of the sequence is created from the name of the original sequence with the start and end positions of the range appended with underscore characters between them,
For example: "XYZ region 2 to 34" is written as: "XYZ_2_34"
To output each of the exons in em:hsfau1 to a separate entry:
% extractseq em:hsfau1 -reg "782..856,951..1095,1557..1612,1787..1912" stdout -separate >HSFAU1_782_856 H.sapiens fau 1 gene atgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacg gtcgcccagatcaag >HSFAU1_951_1095 H.sapiens fau 1 gene gctcatgtagcctcactggagggcattgccccggaagatcaagtcgtgctcctggcaggc gcgcccctggaggatgaggccactctgggccagtgcggggtggaggccctgactaccctg gaagtagcaggccgcatgcttggag >HSFAU1_1557_1612 H.sapiens fau 1 gene gtaaagtccatggttccctggcccgtgctggaaaagtgagaggtcagactcctaag >HSFAU1_1787_1912 H.sapiens fau 1 gene gtggccaaacaggagaagaagaagaagaagacaggtcgggctaagcggcggatgcagtac aaccggcgctttgtcaacgttgtgcccacctttggcaagaagaagggccccaatgccaac tcttaa
| cutseq | Removes a specified section from a sequence |
| degapseq | Removes gap characters from sequences |
| descseq | Alter the name or description of a sequence |
| entret | Reads and writes (returns) flatfile entries |
| infoseq | Displays some simple information about sequences |
| listor | Writes a list file of the logical OR of two sets of sequences |
| maskfeat | Mask off features of a sequence |
| maskseq | Mask off regions of a sequence |
| newseq | Type in a short new sequence |
| noreturn | Removes carriage return from ASCII files |
| notseq | Excludes a set of sequences and writes out the remaining ones |
| nthseq | Writes one sequence from a multiple set of sequences |
| pasteseq | Insert one sequence into another |
| revseq | Reverse and complement a sequence |
| seqret | Reads and writes (returns) sequences |
| seqretall | Reads and writes (returns) a set of sequences one at a time |
| seqretset | Reads and writes (returns) a set of sequences all at once |
| seqretsplit | Reads and writes (returns) sequences in individual files |
| splitter | Split a sequence into (overlapping) smaller sequences |
| swissparse | Retrieves sequences from swissprot using keyword search |
| trimest | Trim poly-A tails off EST sequences |
| trimseq | Trim ambiguous bits off the ends of sequences |
| vectorstrip | Strips out DNA between a pair of vector sequences |